Index Download (AI) Download (PDF) Compass Back
Eo Ena EOE-001
Eo Ena
Curator & Narrator

I bring together what is scattered.
So you can make, understand,
and pass on.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download (AI) Download (PDF) Compass Back
Eo Ena EOE-001
I keep what lasts.

Eo Ena is the narrator of the almanac. She gathers what lies scattered across the worlds and guides you through — so you can make, understand, and pass on.

The nameEo is Latin for 'I go, I travel'. She is the one who sets out and brings back what proves worth the journey.

Fog·Plum·Crow
ggg agc ccc gag acg gtc ctg ctg ccg tac ccc ata cta gaa acg ctt gat ctg aca tcc aag t
Integrity checkEdition 1
AI PDF
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

Every card is a thing of its own, with its own name written in DNA.

Cards belong to a world, but not to a website — you can print them, keep them, and verify them.

Controls
ClickThe card turns over.
MenuThe three lines, top left — back, turn, index, worksheet.
DNAThe code at the bottom is the card's permanent name.
VerifyCheck at /verify/ whether a card is authentic and unaltered.
This sheet is not a card. It is a temporary layer that only exists on a screen — you cannot print it and you cannot collect it.
Index Download (AI) Download (PDF) Compass Back
Tumble Cards EOE-002
Tumble Cards
The medium

Every card is made to outlive this website — and turns with a click.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download (AI) Download (PDF) Compass Back
Tumble Cards EOE-002

No menu, no tree. The almanac is dissolved into loose cards that wander and connect.

Card · The atom. One thing with its own DNA and its own number: verifiable, made to outlive this website — on paper, in a QR, on any domain.
World · Where a card comes from. Its language, colour, type and mark.
Family · Cards that grow together inside a world. Never finished.
Set · A bounded edition. Complete when every card is there.
Stack · Cards in an order that carries meaning: a lesson, a recipe, a route.
Deck · A free selection for one purpose. No order of its own.
Palm·Key·Rust
ttt gat tag ctc atg atg agg ata cag aag tct gag acg taa acg ctt gat ctg aca tcc aat a
Integrity checkEdition 1
AI PDF
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

Every card is a thing of its own, with its own name written in DNA.

Cards belong to a world, but not to a website — you can print them, keep them, and verify them.

Controls
ClickThe card turns over.
MenuThe three lines, top left — back, turn, index, worksheet.
DNAThe code at the bottom is the card's permanent name.
VerifyCheck at /verify/ whether a card is authentic and unaltered.
This sheet is not a card. It is a temporary layer that only exists on a screen — you cannot print it and you cannot collect it.
Index Download (AI) Download (PDF) Compass Back
Worlds EOE-003
Worlds
Where cards come from

A world is where a card comes from — its origin, not its place.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download (AI) Download (PDF) Compass Back
Worlds EOE-003

Every world has a name, a face and a boundary. What a world carries:

Identity · name, code and maker.
Face · its own colour, type and mark. The construction stays shared.
Language · one tongue per world; the card's chrome follows it.
Families and Sets · inside a world, families grow; sets are complete.
Boundaries · origin is fixed on the card; placement is free.
Life · editions and years.
Oak·Owl·Tin
ata gcc atc aga tgt cca aga gaa aaa cga gga att tcg taa acg ctt gat ctg aca tcc aat c
Integrity checkEdition 1
AI PDF
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

Every card is a thing of its own, with its own name written in DNA.

Cards belong to a world, but not to a website — you can print them, keep them, and verify them.

Controls
ClickThe card turns over.
MenuThe three lines, top left — back, turn, index, worksheet.
DNAThe code at the bottom is the card's permanent name.
VerifyCheck at /verify/ whether a card is authentic and unaltered.
This sheet is not a card. It is a temporary layer that only exists on a screen — you cannot print it and you cannot collect it.
Index Download (AI) Download (PDF) Compass Back
The Index EOE-004
The Index
One sheet per world

Every card, by name and by DNA — the full list across all worlds.

Edition 1 The Eo Ena Almanac Turn ↻
Index Download (AI) Download (PDF) Compass Back
The Index EOE-004

The Index keeps every card, across all worlds — findable long after this website.

By name and DNA · the codon name to remember, the full DNA as an anchor that stays.
All worlds · one index across all worlds — one sheet each, not bound to any site.
Growing · the Index is a Stack of sheets; every sheet is a card with its own number, and new sheets are minted as a world fills.
Verify · any card, on any domain it lives on: identity, version and signature.
Open the Index →A stack of sheets — one per world, growing with the almanac.
Green·Bone·Tin
gag gtt atc tta cgc tca cct ggt tcg ttc ctt gga tgg caa acg ctt gat ctg aca tcc aat g
Integrity checkEdition 1
AI PDF
Edition 1 The Eo Ena Almanac Turn ↻

How does this work?

Every card is a thing of its own, with its own name written in DNA.

Cards belong to a world, but not to a website — you can print them, keep them, and verify them.

Controls
ClickThe card turns over.
MenuThe three lines, top left — back, turn, index, worksheet.
DNAThe code at the bottom is the card's permanent name.
VerifyCheck at /verify/ whether a card is authentic and unaltered.
This sheet is not a card. It is a temporary layer that only exists on a screen — you cannot print it and you cannot collect it.

Deck

Eo Ena — de eerste kaarten

DNA
aggaccggaatgcgaacccatgttttttgggccgccaatcaaacgctttcctagccctcacgcg
Appears on
  • eoena.com/kaarten-attctctgctaatatttagccagtcgcaacggtatcacggaaacgcttgatctttcgcggatgt/

Catalog · Signed manifest