# Eo Ena — Cards

## Card

- **Number:** EOE-100
- **Name:** Eo Ena
- **World:** EOE
- **Type:** deck
- **Language:** en
- **ULID:** 01KY6ZV6HV7QF71KY99DJ1NK8T
- **DNA:** attctctgctaatatttagccagtcgcaacggtatcacggaaacgcttgatctttcgcggatgt
- **Version:** c5d7d583 (2026-08-22)
- **Verify:** https://eoena.com/verify/?dna=attctctgctaatatttagccagtcgcaacggtatcacggaaacgcttgatctttcgcggatgt&v=c5d7d583

## Front

The front door of the almanac: Eo Ena introduces herself and explains the system — the cards, the collections, the register.

## Body

The entry deck of eoena.com: four cards that lead you in.

## Relations

- tp:systems: topic
- [Eo Ena](https://eoena.com/): world

## Source

- **Canonical:** https://eoena.com/kaarten-attctctgctaatatttagccagtcgcaacggtatcacggaaacgcttgatctttcgcggatgt/

The canonical HTML page and card.json are the authoritative representations.