Index Print sheet (PDF) Compass Back
Eo Ena W · EOE
Eo Ena kijkt uit over haar almanakwereld World card

An Almanac of Discoveries

Past, present and possible futures.

Edition 1The Eo Ena AlmanacTurn ↻
Index Print sheet (PDF) Compass Back
Eo Ena W · EOE

World

Eo Ena

The front door of the almanac: Eo Ena introduces herself and explains the system — the cards, the worlds, the index.

Edition 1The Eo Ena AlmanacTurn ↻

How does this work?

Every card is a thing of its own, with its own name written in DNA.

Cards belong to a world, but not to a website — you can print them, keep them, and verify them.

Controls
ClickThe card turns over.
MenuThe three lines, top left — back, turn, index, worksheet.
DNAThe code at the bottom is the card's permanent name.
VerifyCheck at /verify/ whether a card is authentic and unaltered.
This sheet is not a card. It is a temporary layer that only exists on a screen — you cannot print it and you cannot collect it.

World

Eo Ena

DNA
ctaagtaatgtcttggattgcttgatctgctacttggtccagcgggagacaggcaatcggaagt
Appears on
  • eoena.com/

Catalog · Signed manifest